Otsing sellest blogist

UUS!!!

Laanemetsad

Blogi, mis räägib kõigest, mis on Leonhardile oluline ja/või huvitav. Kommenteerige, tellige, lugege, nautige ja õppige. Laanemetsad Laaneme...

esmaspäev, 21. august 2023

Geneetika

Blogi, mis räägib kõigest, mis on Leonhardile oluline ja/või huvitav. Kommenteerige, tellige, lugege, nautige ja õppige.
IX. TRANSKRIPTSIOON JA RNA PROTSESSING Elusorganismide geneetilise informatsiooni säilitamiseks ja realiseerimiseks on informatsioonikandja märkimiseks vaja vaid nelja tähte (A, T, G, C). On seda palju või vähe? Võrdluseks, nüüdisaegsetes arvutites on kasutusel vaid 2 arvsümbolit (0, 1), seevastu inglise keeles on 26 tähte, eesti keeles 27 eesti tähestiku tähte ja 5 võõrtähte (c, q, w, x, y) e. 32 tähte. 1. TRANSKRIPTSIOON 1.1. Transkriptsiooni üldpõhimõtted 1.1.1. Molekulaarbioloogia põhipostulaat Molekulaarbioloogia põhipostulaadi (ingl. central dogma of molecular biology) e. Cricki postulaadi kohaselt on geneetilisel informatsioonil kaks põhiomadust (jn. 9.1). 1. Geneetiline informatsioon säilib, kandudes põlvkonnast põlvkonda edasi nukleiinhappelt nukleiinhappele (DNA-lt DNA-le; RNA viirustel, kel genoomiks on RNA, toimub ülekanne RNA-lt RNA-le). 2. Geneetiline informatsioon kandub edasi organismi geenide avaldumisel (fenotüübilisel ekspressioonil) DNA-lt valkudesse, s.t. DNA nukleotiidse järjestuse informatsioon kodeeritakse ümber valkude aminohappeliseks järjestuseks. Geneetilise informatsiooni ülekanne valkudesse on kaheetapiline. 1. Transkriptsioon (ingl. transcription), kus geneetiline informatsioon kandub üle DNA-lt RNA-le. 2. Translatsioon (ingl. translation), kus geneetiline informatsioon kandub üle RNA-lt valku. Geneetilise informatsiooni ülekanne DNA-lt RNA-le on põhimõt eliselt pöörduv protsess. Näiteks, kui transkriptsioonil toimub DNA-sõltuva RNA polümeraasi toimel informatsiooni ülekanne DNA-lt RNA-le, siis vastupidisel protsessil, pöördtranskriptsioonil (ingl. reverse transkription) toimub RNA-sõltuva DNA polümeraasi e. revertaasi toimel geneetilise informatsiooni ülekanne RNA-lt DNA-le. Seevastu geneetilise informatsiooni ülekanne RNA-lt valku on alati pöördumatu (ühesuunaline) protsess. Transkriptsioon ja RNA protsessing 263 Molekulaarbioloogia põhipostulaat ütleb, et geneetiline informatsioon kandub nukleiinhappelt nukleiinhappele ja nukleiinhappelt valku, mit e valgult nukleiinhappele. See tähendab aga ka seda, et keskkonna toimel organismi eluajal omandatud fenotüübilised tunnused ei saa suguliselt sigivatel organismidel järglastele päranduda: ei pärandata tunnuseid, vaid geneetilist informatsiooni, mis tagab iseloomulike tunnuste tekke. 1.1.2. RNA tüübid Transkriptsioonil kasutatakse üht DNA-ahelat matriitsina (ingl. template) komplementaarse RNA-ahela sünteesil. Sünteesitud RNA-ahelat nimetatakse transkriptiks (ingl. transcript). Kuivõrd RNA-s on tümiini asemel uratsiil, siis näiteks juhul, kui matriitsahela DNA-molekulis on nukleotiidne järjestus AAA, vastab sellele RNA transkriptis UUU. Translatsiooni käigus muudetakse („tõlgitakse”) RNA nukleotiidne järjestus valkude aminohappeliseks järjestuseks. Nagu igasuguse info ülekandel ühest märgisüsteemist teise vajatakse selleks koodi, geneetilise info ülekandel geneetilist koodi (ingl. genetic code). Geneetilise koodiga määratakse valkude aminohapped RNA nukleotiidsete tripletite (ingl. triplets) poolt, mida nimetatakse koodoniteks (ingl. codons). Ülalesitatud näites määrab UUU triplet RNA-s valgu polüpeptiidahelasse (geeni produkti) aminohappe fenüülalaniini lülitumise. Translatsioon toimub ribosoomides (ingl. ribosomes), mis koosnevad 3–5 RNAmolekulist, 50–90 erinevast valgust ja reast muudest regulatoorsetest makromolekulidest. Ribosoomides transleeritavaid RNA-molekule nimetatakse informatsiooni-RNA-deks e. mRNA-deks (ingl. messenger RNAs, mRNAs). Prokarüootidel on geeni poolt määratav esmane transkript (ingl. primary transcript) võrdne mRNA-ga ning ta on ka kohe transleeritav (jn. 9.2). Eukarüootides toimub aga esmalt eellas- e. pre-mRNA (ingl. premRNA) süntees, misjärel toimub nn. eellas-mRNA potsessing (ingl. processing) küpseks GENEETILISE INFORMATSIOONI VOOL PÕLVKONNAST PÕLVKONDA RNA DNA RNA DNA Replikatsioon RNA-sõltuv RNA polümeraas DNA-sõltuv DNA polümeraas mRNA Polüpeptiid (valk) RNA-sõltuv DNA polümeraas DNA-sõltuv RNA polümeraas Pöördtranskriptsioon Transkriptsioon FENOTÜÜBI KONTROLL (GEENI AVALDUMINE) Translatsioon Joonis 9.1. Molekulaarbioloogia keskne dogma (Cricki postulaat). Cricki post u laat: geneet i l i ne informatsioon kandub eda si nu k lei i n happelt nukleiinhappele ja nukl e i i n h a p p e l t v a l g u l e , mitte aga valgult nukleiinhappele. 264Transkriptsioon ja RNA protsessing mRNA-molekuliks. Protsessimise käigus toimub enne translatsiooni pre-mRNA-st spetsiif lise järjestuse kõrvaldamine ning transkripti mõlema otsa modif katsioon. Enamikus eukarüootsetes geenides on mit ekodeerivad järjestused e. intronid (ingl. introns), mis lõigatakse RNA protsessingul RNA-st välja, ühendades sellega RNA-s geeni kodeerivad järjestused e. eksonid (ingl. exons). Intronite väljalõikamise protsessi nimetatakse geeni splaissinguks (ingl. gene splicing). Enne splaissingut lisatakse pre-mRNA 5´-otsa 7-metüülguanosiinmüts (ingl. cap) ja 3´-otsa transkriptsioonijärgselt pärast splaissingut 20–200 nukleotiidi pikkune polü-(A)-järjestus e. polü-(A)-saba (ingl. poly-A tail). Splaissingreaktsiooni läbiviimiseks moodustub makromolekulaarne struktuur, mida nimetatakse splaissosoomiks (ingl. spliceosomes). Kõik nimetatud protsessid toimuvad tuumas. Protsessitud mRNA transporditakse tsütoplasmasse, kus ta transleeritakse. Järelikult on transkriptsioon ja translatsioon eukarüootidel ajaliselt ja ruumiliselt lahutatud. Seevastu prokarüootsetes rakkudes toimuvad transkriptsioon ja translatsioon järjestikku: sünteesitud mRNA osaleb kohe ka translatsioonil. Tegelikult transkribeeritakse geenide ekspressioonil koguni viit erinevat tüüpi RNA-sid: mRNA, tRNA, rRNA, snRNA, miRNA. Neist transleeritakse aga vaid ühte, ülalnimetatutest mRNA-d. Ülejäänud neli RNA tüüpi on lõpp-produktid. TransportRNA-d e. tRNA-d (ingl. transfer RNAs, tRNAs) on madalmolekulaarsed RNA-d, mis funktsioneerivad translatsioonil kui adapterid aminohapete ja mRNA koodonite vahel. Ekson Intron Ekson Geen Geen mRNA Pre-mRNA MG- -(A)n -(A) MG-müts- n Valk Valk Transkriptsioon DNA DNA Transkriptsioon Translatsioon Translatsioon Transport Protsessing Splaissing Tuum A Prokarüoot B Eukarüoot Rakk Rakk Ekson Intron Ekson mRNA Joonis 9.2. Pro- (A) ja eukarüootide (B) valgusünteesi kaks etappi: transkriptsioon ja translatsioon. Eukarüootide tuumas toimub (sageli) pre-mRNA-st intronite kõrvaldamine (geeni splaissing). Eukarüootide tuumas toimub mRNA modif katsioon (protsessing): 5´-otsa 7-metüülguanosiin-(MG)-mütsi ja 3´-otsa polü(A)-saba lisamine. Eukarüootide mRNA transporditakse tuumast tsütoplasmasse. Prokarüootidel toimub nii transkriptsioon kui ka translatsioon järjestikuliselt – need pole ajas ja ruumis lahutatud protsessid. Transkriptsioon ja RNA protsessing 265 Ribosoomi-RNA-d e. rRNA-d (ingl. ribosomal RNAs, rRNAs) on ribosoomide struktuurseteks ja katalüütilisteks komponentideks. Väikesed tuuma-RNA-d e. snRNA-d (ingl. small nuclear RNAs, snRNAs) on splaissosoomide struktuurikomponentideks. Mikro-RNA-d e. miRNA-d (ingl. micro RNAs, miRNAs) on 20–25 nukleotiidi pikkused üksikahelalised RNA-molekulid, mis lõigatakse välja väikestest juuksenõelastruktuuriga RNA prekursoritest (eellasmolekulidest) ning neil on võime blokeerida nendega komplementaarse või osaliselt komplementaarse mRNA avaldumist, põhjustades viimase degradatsiooni või pidurdades translatsiooni. Kõik ülalnimetatud eri tüüpi R NA-d sünteesitakse eukarüootide tuumades. Neist vaid üks, snRNA toimib tuumas, ülejäänud neli (mRNA, tRNA, rRNA ja premiRNA) transporditakse tuumast tsütoplasmasse, kus toimub translatsioon (jn. 9.3). RNA-d protsessitakse tuumas. Erandina transporditakse tsütoplasmasse miRNA eellane pre-miRNA, mis protsessitakse alles tsütoplasmas aktiivseks miRNA-ks. Tuumas sünteesitud pre-miRNA sekundaarsed kaksikahelalised alad lõigatakse tuumas katki Drosha-ensüümiga (ingl. Drosha enzyme), pre-miRNA väljub tuumast tsütoplasmasse, kus toimub kaksikahelalise RNA järkamine (ingl. dice) ning trimmimine (ingl. RNA trimming) teise ensüümiga – Diceri-nukleaasiga miRNA-ks. Viimane seostub valkudega miRICS-kompleksiks. miRICS-i koosseisus olev üksikahelaline miRNA seondub oma märklaudjärjestusele mRNA-s ning blokeerib sellega mRNA translatsiooni. Siinjuures Joonis 9.3. Valgusünteesi komponendid eukarüoodil. Transkriptsioonilised RNA-d: mRNA, miRNA, rRNA, snRNA, tRNA. snRNA splaissingu funktsioon splaissosoomis. mRNA, rRNA, tRNA ribosoomide ja aminohapete osalus translatsioonil tsütoplasmas. miRNA regulatiivne funktsioon: Drosha on ensüüm, mis lõikab tuumas pre-miRNA-st välja kaksikahelalised RNA osad; Dicer on nukleaas, mis trimmib pre-miRNA-st miRNA; RICS on RNA indutseeritud translatsiooni vaigistav kompleks. U5 U1 DNA Transkriptsioon RNA protsessing snRNA rRNA tRNA mRNA Pre-miRNA U6 U4 U2 Splaissosoom RNA transkript Pre-miRNA mRNA tRNA rRNA Dicer-nukleaas Ribosoomivalgud mRNA mRNA degradatsioon Translatsiooni repressioon Aminohapped Translatsioon Polüpeptiid Transkriptsioon Tsütoplasma Tuum RICS Ribosoom Drosha-nukleaas miRNA 266Transkriptsioon ja RNA protsessing aga blokeeritud mRNA-d ei degradeerita ning neid saab edaspidi kasutada. Seega miRNA vaid moduleerib valgusünteesi toimumist rakus. miRNA on peale eukarüootide ka eukarüootsetes viirustes. Näiteks herpesviiruses kodeeritakse 140 erisugust miRNA-d. 1.1.3. RNA süntees ja lagundamine RNA süntees on põhimõt eliselt sarnane DNA sünteesiga. Erinevused on vaid järgmised. 1. Eellasmolekulid (prekursorid) on ribonukleotiidtrifosfaadid (mit e desoksüribonukleotiid-trifosfaadid). 2. Komplementaarse RNA-ahela sünteesil kasutatakse matriitsina vaid üht DNAahelat. 3. RNA-ahela sünteesi saab initsieerida de novo, ilma praimerahela (ja selle vaba 3´-OH otsa) olemasoluta. Moodustuv RNA-ahel on komplementaarne DNA matriitsahelaga (ingl. template strand) (jn. 9.4), selle erinevusega, et T asemel on U. Teist DNA-ahelat nimetatakse mit e matriitsahelaks (ingl. nontemplate strand). mRNA-molekulid on RNA kodeerivateks ahelateks e. mõt elisteks e. senss-ahelateks (ingl. sens strands), sest nende info kandub edasi polüpeptiidahela aminohappelisse järjestusse. mRNA-ga komplementaarsed RNA-molekulid on vastasmõt elised e. antisenss-RNA-d (ingl. antisense RNAs). Teoreetiliselt on antisenss-RNA geeni (DNA) mit ematriitsahelalt sünteesitud mRNA-le komplementaarne RNA. Tegelikkuses on genoomis kindlad nn. vastasgeenid, millelt CGTATGCTAGTCCGATTGCG GCATACGATCAGGCTAACGC GCAUACGAUCAGGCUAACGC CGTATGCTAGTCCGATTGCG Matriitsahel Mittematriitsahel DNA 3´ 5´ 3´ 5´ RNA süntees mRNA 3´ 5´ 3´ 5´ Matriitsahel RNA DNA Senss-RNA ahel RNA süntees Antisenss-RNA 3´ 5´ RNA DNA 5´ GCATACGATCAGGCTAACGC 3´ Mittematriitsahel Antisenss-RNA ahel CGUAUGCUAGUCCGAUUGCG Joonis 9.4. RNA süntees toimub vaid ühel DNA-ahelal. mRNA sünteesitakse DNA matriitsahelal. RNA sünteesil loetakse geneetilist informatsiooni 3´→ 5´ ahelalt, süntees toimub suunas 5´→ 3´. Sünteesitud 5´→ 3´ RNA-ahel on komplementaarne DNA 5´→ 3´ mit ematriitsahelaga (T asemel on vaid U). Antisenss-RNA on kui DNA mit ematriitsahelal sünteesitud RNA. Transkriptsioon ja RNA protsessing 267 moodustatakse antisenss-RNA-d, mis võivad paarduda mitmete mRNA-de märklaudjärjestustega ning blokeerida sellega mRNA translatsiooni. Tüüpiliselt on antisenss-RNA-d ca 100 nukleotiidi pikad ning nende seondumisjärjestus on ca 30 nukleotiidi pikkune. Antisenss-R NA-de kui väikeste regulatoorsete R NA-de seondumine mR NA äratundmisjärjestustele sõltub väikesest spetsiif lisest Hfg-valgust, mida nimetatakse RNA-tšaperoniks (ingl. RNA chaperon), sest see valk aitab väikestel RNA-molekulidel hoida oma korrektset struktuuri. Hfg-valk moodustab mRNA ja antisenss-RNA paardumisel nende ümber moodustuvate tasapindade heksameerse struktuuri ning selle kompleksiga seondub veel ribonukleaas E, mis alustab mRNA degradeerimist. RNA-ahela süntees toimub nagu DNA puhulgi suunas 5´ → 3´, kus ribonukleotiide lisatakse ahela lõppu, 3´-hüdroksüülgrupi (3´-OH) külge. Analoogselt DNA-sünteesiga toimub selles reaktsioonis 3´-OH nukleof ilne rünnak eellasmolekuli, ribonukleotiidtrifosfaadi kolme fosfaadi sisemisele (nukleotidüül)fosforiaatomile ning sellega kaasneb pürofosfaadi vabanemine (jn. 9.5). RNA-sse lülituv nukleotiid on komplementaarne vastasoleva DNA matriitsahela nukleotiidiga. O CH2 H H H H O P O O O O CH2 H H H H O P O O O O CH2 H H H H O P O O O O CH2 H H H H O O P O O O CH2 O P O O O CH2 O H H OH H H O H OH H OH H H O P O O O P CH2 O O O P O O O H OH H OH H H O Uue sideme moodustumine Tsütosiin Guaniin Guaniin Tsütosiin Uratsiil Adeniin Tümiin H H H H O 3´ 5´ 3´ 5´ Saabuv ribonukleotiidtrifosfaat Ahela pikenemine RNA DNA Joonis 9.5. RNA-ahela elongatsioon suunas 5´→ 3´ RNA polümeraasi toimel. 268Transkriptsioon ja RNA protsessing RNA sünteesi teostab ensüüm RNA polümeraas (ingl. RNA polymerase). Summaarset reaktsiooni väljendatakse järgmiselt: DNA matriits n(RTP) → → → → (RMP)n + n(PP), RNA polümeraas kus n on kasutatud ribonukleotiidtrifosfaatide (RTP), RNA-sse lülitunud ribonukleotiidmonofosfaatide (RMP) ja vabanenud pürofosfaatide (PP) hulk. RNA polümeraas seondub ja alustab transkriptsiooni DNA spetsiif listelt järjestustelt, mida nimetatakse promootoriks (ingl. promoter). Pro- ja eukarüootsetel geenidel on promootorjärjestused erinevad. Transkriptsiooni initsiatsiooni promootoritelt reguleeritakse transkriptsioonifaktorite (ingl. transcription factors) seondumisega promootoriga. Transkriptsioonifaktorid on nii positiivsed kui ka negatiivsed regulaatorvalgud, kusjuures positiivsed regulaatorvalgud soodustavad ja negatiivsed pidurdavad transkriptsiooni alustamist. Transkriptsioon toimub RNA polümeraasi toimel lokaalselt lahtikeerdunud DNA-lõigul, mida nimetatakse ka transkriptsioonisilmaks või transkriptsioonimulliks (ingl. transcription bubble) (jn. 9.6). Prokarüootidel on üks RNA polümeraas, eukarüootsetes rakkudes aga kolm erinevat RNA polümeraasi, kuivõrd viimasel juhul katalüüsivad erinevad polümeraasid eri tüüpi RNA-molekulide sünteesi. C A U G U A A A U U U U C A G A U U A G G T A C A T T T A A A A G T C T A A T C G C T T A C A T G T A A A T T T T C A G A T T A G C G A A T RNA DNA matriitsahel Lokaalselt lahtikeerdunud DNA-fragment RNA polümeraas 5´ 5´ 5´ 3´ 3´ 3´ RNA/DNA hübriid DNA mittematriitsahel Joonis 9.6. RNA süntees lokaalselt lahtikeerdunud DNA piirkonnas e. transkriptsioonisilmas. Transkriptsioonisilmas on näha, et vaid mõned ük sikud DNA matriitsahela nuk leotiidid on aluspaardunud kasvava RNAahela lõpus (R NA/DNA hübriid). DNA-molekuli lahtikeerdumist enne ja tagasi kinnikeerdumist pärast replikatsioonisilma katalüüsitakse RNA polümeraasi poolt. Meeldejätmiseks • Molekulaarbioloogia põhipostulaat ütleb, et geneetiline informatsioon kandub nukleiinhappelt nukleiinhappele ja nukleiinhappelt valku, mitte valgult nukleiinhappele. • Transkriptsioonil sünteesitakse RNA transkript, mis on komplementaarne geeni DNA ühe ahelaga. • Transkribeeritakse viit erinevat tüüpi RNA-molekule (mRNA, tRNA, rRNA, snRNA, miRNA), milledest transleeritakse vaid mRNA-d. • Translatsioonil konverteeritakse RNA nukleotiidses järjestuses sisalduv geneetiline informatsioon valkude polüpeptiidide aminohappeliseks järjestuseks (geeni produktiks) geneetilise koodi abil. Transkriptsioon ja RNA protsessing 269 • Eukarüootsed geenid asuvad tuumas, polüpeptiidid sünteesitakse aga tsütoplasmas. • Transkriptsioonil moodustuvad RNA-d protsessitakse valdavalt tuumas ja transporditakse tsütoplasmasse, v.a. miRNA. • Geneetilise informatsiooni ülekande vaheühendiks on mRNA, millega kantakse informatsioon DNA-lt ribosoomidesse, kus toimub valgusüntees. • RNA polümeraasi poolt katalüüsitav RNA-süntees on väga sarnane DNA-sünteesiga. • RNA-süntees toimub lokaalselt lahtikeerdunud DNA-lõigul, mis algab promootorist ning kus RNA-sünteesi matriitsina kasutatakse vaid üht DNA-ahelat. 1.2. Transkriptsioon prokarüootidel Transkriptsiooni põhietapid on pro- ja eukarüootidel samased, kuid on ka olulisi erinevusi, näiteks juba nimetatud promootorite nukleotiidsed järjestused. Lisaks on RNA polümeraasid pro- ja eukarüootidel, eriti arhedel, erisuguse ehitusega. DNA segment, mis transkribeeritakse üheks R NA-molekuliks, kannab nime - tust „transkriptsiooniüksus” (ingl. transcription unit). Eukarüootidel on transkriptsiooniüksus sageli ekvivalentne individuaalse geeniga. Prokarüootidel on transkriptsiooniüksuseks aga mitu geeni, mis on osa operonist (ingl. operon). Operoni koosseisu kuuluvad veel operoni geene reguleerivad DNA-järjestused. Operonilt sünteesitud RNA-molekuli nimetatakse polütsistroonseks RNA-ks (ingl. polycistronic RNA). Transkriptsioonil eristatakse kolme staadiumi (jn. 9.7). 1. Uue RNA-ahela alustamine e. initsiatsioon (ingl. initiation). 2. Ahela pikenemine e. elongatsioon (ingl. elongation). 3. Transkriptsiooni lõpetamine e. terminatsioon (ingl. termination) ja valmis RNAmolekuli vabanemine. Transkriptsiooni kirjeldamisel kasutatakse termineid „ülesvoolujärjestused” (ingl. upstream sequences) ja „allavoolujärjestused” (ingl. downstream sequences) tähistamaks DNA piirkondi, mis jäävad transkribeeritavast alast kodeerivas DNA-ahelas vastavalt 5´- ja 3´-otsa suundadesse. Selline eristus põhineb faktil, et RNA süntees toimub alati suunas 5´ → 3´. Geeni üles- ja allavoolujärjestused kirjeldavad seega geeni 5´ ja 3´ DNAjärjestusi, mis jäävad transkriptsiooni alguspunktist vastavalt vasakule või paremale. Prokarüootidel algab translatsioon ja mRNA-molekulide degradatsioon sageli enne, kui nende süntees (transkriptsioon) veel lõpebki. Selline samaaegne toime on võimalik, sest mRNA-molekulid sünteesitakse, transleeritakse ja degradeeritakse samaselt, suunas 5´ → 3´. Lisaks pole prokarüootidel peptiidide sünteesi masinavärk (valgu süntees) ruumiliselt mRNA sünteesist eraldatud – neil pole tuumamembraaniga piiritletud tuuma nagu ka teisi membraaniga ühendatud organelle. 1.2.1. RNA polümeraas Prokarüootide RNA polümeraas on multimeerne valk molekulmassiga ca 480 000 daltonit. RNA polümeraas koosneb viiest alaüksusest e. alaühikust. Kompleksse RNA polümeraasi molekuli e. holoensüümi (ingl. holoenzyme) koostis on α2 ββ´σ ning selline 270Transkriptsioon ja RNA protsessing kompleks on vajalik transkriptsiooni initsieerimiseks (alustamiseks). Elongatsiooni viib läbi RNA polümeraasi põhiensüüm e. apoensüüm (ingl. apoenzyme), mis on tetrameerne valk koostisega α2 ββ´. α-subühikud osalevad RNA polümeraasi apoensüümi assambleerimisel (kokkupakkimisel), β-subühik sisaldab ribonukleosiidtrifosfaadi seondumissaiti ja β´-subühik DNA matriitsahelaga seondumise piirkonda. Sigmafaktor (ingl. sigma (σ) factor) on vajalik vaid transkriptsiooni initsiatsiooniks. Pärast transkriptsiooni alustamist ta vabaneb ning RNA-ahela edasist pikenemist (elongatsiooni) viib läbi juba RNA polümeraasi apoensüüm. Sigmafaktori funktsiooniks on ära tunda ja seondada RNA polümeraas DNA-promootorsaiti. Bakteritel on mitmed erinevad ning spetsiif lised sigmafaktorid, mis võimaldavad RNA polümeraasil seonduda erinevate promootorjärjestustega. Neist põhiline on σ70. RNA polümeraasi holoensüüm (σ esineb) on võimeline alustama RNAahela sünteesi ka in vitro, kuid üksnes samadest saitidest kui in vivo. Seevastu R NA polümeraasi apoensüüm (σ puudub) on võimeline läbi viima RNA sünteesi in vitro ainult ebaspetsiif liselt. Sel puhul toimub RNA sünteesi alustamine (initsiatsioon) juhuslikult jaotuvatest punktidest ning mõlemalt DNA-ahelalt. 1.2.2. RNA-ahela initsiatsioon Transkriptsiooni initsiatsioon jaotatakse kolmeks etapiks. 1. RNA polümeraasi holoensüümi seondumine DNA promootorpiirkonda. 2. RNA polümeraasi toimel DNA kaksikahela lokaalne lahtikeerdumine, millega matriitsahel muutub vabaks, et võimaldada paardumist saabuvate ribonukleotiididega. DNA DNA DNA RNA polümeraas RNA 5´-ots Kasvav RNA-ahel Valmis RNA-molekul RNA-ahela initsiatsioon RNA-ahela elongatsioon RNA-ahela terminatsioon 1 2 3 Joonis 9.7. Prokarüootse transkriptsiooni kolm etappi: initsiatsioon, elongatsioon ja terminatsioon. Transkriptsioon ja RNA protsessing 271 3. Fosfodiestersideme moodustumine, kus kasvavasse RNA-ahelasse lülitatakse esimesed ribonukleotiidid. RNA polümeraasi holoensüüm jääb promootoriga seotuks (ilma et RNA polümeraas liiguks mööda DNA-ahelat edasi) esimese 8–9 fosfodiestersideme moodustumisel. Transkriptsiooni initsiatsioonil sünteesitakse seega lühikesi RNA-lõike (2–9 nukleotiidi). Kui need vabanevad, siis sellega transkriptsioon ka lõpeb ning tegemist on abortiivse transkriptsiooniga (ingl. abortive transcription). Abortiivne transkriptsioon lõpeb juhul, kui on sünteesitud juba 10 või rohkem ribonukleotiidi. Sel juhul vabaneb sigmafaktor ning RNA polümeraasi põhiensüüm (apoensüüm) liigub edasi mööda DNA-ahelat promootorist allavoolu ning jätkab RNA-ahela elongatsiooni (pikendamist). Kokkuleppeliselt nummerdatakse transkriptsiooni initsiatsiooni piirkonnas nukleotiide, lähtudes transkriptsiooni initsiatsioonisaidist. Esimene nukleotiidipaar (märgitakse +1) vastab RNA transkripti esimesele (5´) nukleotiidile. Initsiatsioonisaidile eelnevaid nukleotiidipaare tähistatakse miinusmärgiga, initsiatsioonisaidile järgnevaid plussmärgiga. Nimetatud järjestusi nimetatakse ka vastavalt üles- ja allavoolu esinevateks nukleotiidijärjestusteks. Prokarüootsed promootorid erinevad üksteisest oluliselt. Selleks, et sigmafaktor saaks spetsiif liselt ära tunda promootoripiirkonna, on vajalikud konserveerunud nukleotiidijärjestusega piirkonnad. Kahe konserveerunud piirkonna keskpunktid asuvad 10 ja 35 nukleotiidipaari kaugusel transkriptsiooni initsiatsioonisaidist ülesvoolu ning neid järjestusi nimetatakse seepärast vastavalt –10- ja –35-järjestusteks (ingl. –10 and –35 sequences) (jn. 9.8). Kuivõrd need järjestused on erinevatel liikidel pea ühesugused, nimetatakse neid konsensusjärjestusteks (ingl. consensus sequences). Tavaliselt on need järjestused heksameersed: –10-järjestus mit ematriitsahelal on TATAAT ja –35-järjestus TTGAGC. Kuna sigmafaktor tunneb kõigepealt ära –35-järjestuse ja seondub sellega, siis nimetatakse seda järjestust ka äratundmisjärjestuseks (ingl. recognition sequence). AT-rikas –10-järjestus võimaldab DNA-s esmast kaksikahelate lahtikeerdumist, andes eelduse, et RNA süntees saaks üldse alata. Üldiselt on –10- ja –35-järjestuste vahemaa tugevasti konserveerunud: mit e kunagi pole see väiksem kui 15 ja suurem kui 20 nukleotiidipaari. Transkriptsioooni alguspunkt jääb –10-järjestusest 5–9 nukleotiidi allavoolu. Geeni RNA-transkripti esimeseks 5´-aluseks on E. coli´l üle 90%-l juhtudest puriin. 1.2.3. RNA-ahela elongatsioon R NA-ahela elongatsiooni katalüüsib R NA polümeraasi põhiensüüm, millest on vabanenud sigma faktor. RNA-ahelate kovalentsete sidemetega (ribonukleotiidide lisandumisega) pikenemine toimub transkriptsioonisilmas lokaalselt lahtikeerdunud DNA alal. RNA polümeraasil on nii DNA-d lahtikeerav kui ka tagasi kokkukeerav aktiivsus: RNA polümeraas katalüüsib pidevalt DNA-ahelate lahtikeerdumist enne polümerisatsioonisaiti ning põhjustab komplementaarsete ahelate kokkukeerdumist pärast polümerisatsioonisaiti, liikudes samal ajal piki DNA kaksikheeliksit edasi (jn. 9.9). E. coli´l on transkriptsioonisilma keskmine pikkus 18 nukleotiidipaari ning sekundis lülitatakse kasvavasse RNA-ahelasse ca 40 ribonukleotiidi. Tekkiv R NA-ahel vabaneb DNA matriitsahelalt RNA polümeraasi edasiliikumisel mööda DNA-d. Tegelik 272Transkriptsioon ja RNA protsessing T T A A A T A A C T G T T T G A C A A T A T A T T või C A või G 16–19 bp 5 – 9 bp Äratundmisjärjestus e. –35-järjestus -10-järjestus Transkriptsioon Matriitsahel Mittematriitsahel 5´ 5´ 3´ 3´ Transkriptsioonisilm Ülesvoolusuund Allavoolusuund Joonis 9.8. E. coli tüüpiline promootor. RNA polümeraas seostub promootori –35-järjestusega ja initsieerib DNA-ahelate lahtikeerdumise A-T-rikkas –10-piirkonnas. Transkriptsioon algab transkriptsioonisilma saidis, mis on –10-järjestusest 5–9 bp allavoolu. DNA kaksikheeliks RNA polümeraas Lühike DNA/RNA kaksikheeliks DNA Lahtikeerdumissait Kinnikeerdumissait Lahtikeerdumissait Kinnikeerdumissait Ribonukleotiidide sisenemise sait Kasvav RNAahel DNA kaksikheeliks Kasvav RNAahel Transkriptsioonikompleks A B RNA polümeraasi liikumissuund DNA RNA polümeraas 5´ 5´ 3´ 3´ Transkriptsioonisilm Joonis 9.9. RNA polümeraasi poolt katalüüsitav RNA-ahela pikenemine (elongatsioon) E. coli´s. A. RNA polümeraas seondub DNA-ga ja pikendab kovalentselt RNA-ahelat. B. RNA polümeraas liigub allavoolu koos RNA-ahela pikenemisega. Transkriptsioon ja RNA protsessing 273 paardumisala DNA matriitsahela ja kasvava RNA-ahela vahel on lühikene – pikkus kuni kolm nukleotiidipaari. Seetõt u saavutatakse transkriptsioonikompleksi stabiilsus tänu DNA-ahela ja kasvava RNA-ahela seondumisele RNA polümeraasiga. 1.2.4. RNA-ahela terminatsioon RNA-ahela süntees lõpetatakse (termineeritakse) siis, kui RNA polümeraas kohtab terminatsioonisignaali (ingl. termination signal). Terminatsioonisignaal põhjustab transkriptsioonikompleksi dissotsieerumist ning moodustunud RNA-molekuli vabanemist. E. coli´l tuleb et e kaht tüüpi transkriptsiooni terminatsiooni: 1) Rho-sõltuv terminatsioon (ingl. rho-dependent termination), kus Rho-valgu olemasolu on hädavajalik; 2) Rho-sõltumatu terminatsioon (ingl. rho-independent termination), kuis Rhovalgu olemasolu pole vajalik. Transkriptsiooni terminatsioonijärjestust, mis tunneb ära Rho(ρ)-valgu, nimetatakse Rho-sõltuvaks terminaatoriks, Rho-valku mit etundvaid terminatsioonijärjestusi aga Rho-sõltumatuteks terminaatoriteks. Rho-sõltumatud terminaatorid sisaldavad DNA-s GC-rikast piirkonda, millele järgneb 6 või rohkem AT-aluspaari, kus N-alus A asub matriitsahelas (jn. 9.10). GC-rikas piirkond asub DNA-s selliselt, et üksikahelalises RNA-s saab vastav piirkond moodustada sekundaarseid kaksikahelalisi RNA piirkondi (juuksenõelasarnaseid struktuure). Juuksenõelastruktuurid (ingl. hairpin structures) moodustuvad kohe pärast vastavate RNA piirkondade sünteesi. Sellega aeglustatakse RNA polümeraasi liikumist mööda DNA-d (põhjustab pause ahela pikenemisel). Kuna järgnev AU-aluspaardumine nõuab CCCACTGCCGCCAGTTCCGCTGGCGGCATTTTTTCTTTCTTTAATGA GGGTGACGGCGGTCAAGGCGACCGCCGTAAAAAAGAAAGAAATTACT Voltunud RNA-ahel soodustab RNAahela transkriptsiooni terminatsiooni Inverteeritud järjestuste transkriptsioon CCCACAGCCGCCAGUUCCGCUGGCGGCAUUUUUU -OH 5´ 3´ 3´ 5´ 5´ 3´ 5´ C C C A C G C A U C G C G G C C G C G G C T A U U U U U U -OH U C C 3´ Matriitsahel RNA kiire voltumine RNA transkript RNA juuksenõelastruktuur DNA Inverteeritud järjestused U G J o o n i s 9.10 . R h o - s õ l t u m a t u transk riptsiooni terminatsioon prokarüootidel. R ho-sõltumatu terminatsioonijärjestus on G-Crikas inverteeritud järjestustega piirkond, millele järgneb minimaalselt 6 A-T-aluspaari. G-C-rikas piirkond moodustab RNA transk riptis juuksenõelastr uktuuri (ahelasisese R NA kaksikahela), millega takistatakse RNA polümeraasi liikumist piki DNAm o l e k u l i j a p õ h j u s t a t a k s e transk riptsiooni terminatsioon külgnevas A-T-rikkas piirkonnas. 274Transkriptsioon ja RNA protsessing ahelate lahknemiseks vähem energiat (kaks H-sidet), siis RNA transkripti U-piirkonna süntees soodustab uuestisünteesitud RNA-ahela lahtitulekut (dissotsieerumist) DNA matriitsilt juhul, kui eelnevalt oli moodustunud GC-juuksenõelastruktuur ja RNA polümeraasi liikuvus oli seetõt u aeglustunud. Rho-sõltuvad terminaatorid (nt. rRNA sünteesi puhul) on samuti GC-rikkad piirkonnad, kus RNA transkriptis on valdavalt C-nukleotiidid. Rho-valk seondub kasvava RNA-ahelaga ja liigub transkriptsioonikompleksi järel mööda RNA-d suunas 5´→ 3´ ning kui RNA polümeraas aeglustab oma liikumist või peatub Rho-sõltuva terminatsioonijärjestuse juures, siis jõuab Rho-valk RNA polümeraasile järele ja tõukab sünteesitud RNA-ahela transkriptsioonikompleksist (transkriptsioonisilmast) välja. Meeldejätmiseks • RNA sünteesil on kolm etappi: initsiatsioon, elongatsioon ja terminatsioon. • Transkriptsiooni katalüüsivad RNA polümeraasid on komplekssed multimeersed ensüümid. • RNA-ahela kovalentne pikenemine toimub DNA lokaalselt lahtikeerdunud ahelate piirkonnas. • RNA-ahela pikenemine katkeb, kui RNA polümeraas kohtab transkriptsiooni terminatsiooni signaali. • Prokarüootidel toimub mRNA-molekulide transkriptsioon, translatsioon ja degradatsioon sageli samal ajal. 1.3. Transkriptsioon ja RNA protsessing eukarüootidel Eukarüootidel transkribeeritakse korraga valdavalt vaid üht geeni, kuid siiski on multigeensete transkriptide osa eukarüootidel väga suur. Näiteks varbussi (Caenorhabditis elegans) transkriptidest on üks neljandik multigeensed. Kuigi eukarüootidel on kolme tüüpi RNA polümeraase, läbivad eukarüootsed transkriptid ikkagi sarnased protsessingud. Eukarüootsete transkriptide modif katsioon toimub enne transkriptide transporti tuumast tsütoplasmasse. Põhilisi modif katsioonitüüpe on kolm (jn. 9.11). 1. mRNA esmase (primaarse) transkripti 5´-otsa lisatakse vastupidises suunas 5´-5´-fosfaatsidemega 7-metüülguanosiin-5´-müts (ingl. 5´cap). 2. Transkriptide 3´-otsa lisatakse polü(A)-polümeraasi (ingl. poly(A) polymerase) abil 20– 200 nukleotiidi pikad polü(A)-sabad (ingl. poly(A) tails). 3. Intronid splaissitakse transkriptidest välja. Eukarüootide tuumas olevaid primaarseid transkripte nimetatakse heterogeenseks tuuma-RNA-ks e. hnRNA-ks (ingl. heterogenous nuclear RNA, hnRNA), sest see koosneb väga erineva suurusega RNA-molekulidest. Suurem osa hnRNA-st on mit ekodeeriv ning sisaldab intronite järjestusi. Pärast tuumas toimuvat RNA-protsessingut (ingl. RNA processing) kaetakse transkriptid RNA-seoseliste valkudega (ingl. RNA-binding proteins). Need valgud kaitsevad RNA-d teda lagundavate ensüümide e. ribonukleaaside (ingl. ribonucleases) toime eest (transkriptide transportimisel tuumast tsütoplasmasse). Selline transkriptide valguline kaitse on vajalik, sest eukarüootsete geenide transkriptide poolestusaeg on oluliselt pikem kui prokarüootidel (ca 5 tundi, võrreldes E. coli transkriptide vähem kui 5 minutiga). Transkriptsioon ja RNA protsessing 275 O P O O CH2 O P O O O P O O O H H O CH2 OH H OH O P O O O O O H H H H CH3 CH3 N + N N N OH N H2 5´ 3´ 5´ 2´ N-alus Riboos 7-metüülguanosiin DNA Pre-mRNA 5´-müts 5´-müts 5´-müts 5´-müts 3´-polü(A)-saba 3´-polü(A)-saba 3´-polü(A)-saba -AAAAA(A)~190AAAA-OH 3´ Intron Transkriptsioon 1 2 3 7-MG-mütsi lisamine 5´-otsa Polü(A)-saba lisamine 3´-otsa Introni kõrvaldamine splaissingul mRNA Intron Intron Endonukleaasse katke sait Joonis 9.11. Eukarüootsete geenide kolm transkriptsioonijärgset RNA protsessingu sündmust. 1 – 7-metüülguanosiin-(MG)-mütsi lisamine pre-mRNA 5´-otsa 5´-5´-fosfaatsidemega. 2 – polü(A)-saba lisamine 3´-otsa. 3 – intronite kõrvaldamine geeni splaissingul. 276Transkriptsioon ja RNA protsessing 1.3.1. Kolm RNA polümeraasi Kõikides eukarüootides (k.a. näiteks üherakulised pärmseened) on kolm tüüpi RNA polümeraase: RNA polümeraas I, II ja III (ingl. RNA polymerases I, II and III) (jn. 9.12). Kõik need polümeraasid on palju komplekssemad kui prokarüootide RNA polümeraas. Nad sisaldavad 10 või rohkem alaüksust. Erinevalt prokarüootide RNA polümeraasidest on kõigi eukarüootsete polümeraaside töötamise eeltingimuseks transkriptsiooni initsiatsioonil transkriptsioonifaktorite olemasolu. Resistentne Tundlik Osaliselt tundlik tRNA, 5S rRNA, snRNA Pre-mRNA 5,8S rRNA, 18S rRNA, 23S rRNA RNA polümeraas I RNA polümeraas III RNA polümeraas II Tuumake Tuum Tundlikkus Į-amanitiini suhtes siRNA, siRNA antisenssjärjestused RNA polümeraas V Taimeraku tuum siRNA RNA polümeraas IV Kromatiini ümbermodelleerimine Joonis 9.12. Eukarüootide kolme eri tüübi RNA polümeraasi üldiseloomustus. RNA polümeraas I on tuumakeses, RNA polümeraasid II ja III tuumas ning RNA polümeraasid IV ja V esinevad vaid taimerakkudes kromatiini ümbermodelleerimise teostamisel siRNA või siRNA märklaudjärjestuste antisenssjärjestuste moodustamisel. Eukarüootide RNA polümeraas I paikneb tuumakeses, kus sünteesitakse rRNA ning mis seostatakse ribosoomivalkudega juba tsütoplasmas. RNA polümeraas I katalüüsib kõigi rRNA-de sünteesi, v.a. 5S rRNA. Vaid RNA polümeraas II transkribeerib valke kodeerivaid tuuma geene, s.t. sünteesib pre-mRNA-d, aga ka miRNA-d. RNA polümeraas III katalüüsib tRNA-, 5S rRNA- ja snRNA-molekulide sünteesi. Erinevatel eukarüootsetel RNA polümeraasidel on erisugune tundlikkus α-amanitiini suhtes: polümeraas I pole tundlik, polümeraas II aktiivsus inhibeeritakse täielikult juba mürgi madalatel kontsentratsioonidel ja polümeraas III on vahepealse tundlikkusega. α-amanitiin on metabolismimürk, mida sisaldab kärbseseen (Amanita phalloides). 1.3.2. RNA-ahela initsiatsioon Eukarüootsed RNA polümeraasid pole, erinevalt prokarüootsest RNA polümeraasist, võimelised initsieerima ise transkriptsiooni. Eukarüootsete RNA polümeraaside seondumiseks DNA-ga on eelnevalt vajalik põhiliste transkriptsioonifaktorite (ingl. basal transcription factors) seondumine promootorijärjestustega. Seejuures on promootorid ja transkriptsioonifaktorid erisuguste geenide puhul väga erinevad. Kõikide RNA polümeraaside puhul toimub DNA kaksikahelate lokaalne teineteisest eraldumine ning vaba matriitsahela moodustumine. Transkriptsiooniüksuse Transkriptsioon ja RNA protsessing 277 promootoriga interakteeruvad seejuures mitmed erinevad transkriptsioonifaktorid. RNA polümeraas II poolt äratuntavad promootorid sisaldavad konserveerunud järjestuselemente e. mooduleid, mis asuvad transkriptsiooni algussaidist ülesvoolu. Joonisel 9.13 on esitatud hiire tümidiinkinaasi geeni promootori konsensusjärjestused. Teised RNA polümeraas II poolt äratuntavad promootorid sisaldavad neist komponentidest vaid osa. Tran skriptsiooni algussaidile (+1) lähim konsensusjärjestus on TATA-järjestus (ingl. TATA box) konsensusjärjestusega TATA A A A (lugedes mittematriitsahelal suunas 5´→ 3´), mis paikneb keskmisest nukleotiidist ca –30 nukleotiidi kaugusel. TATA-järjestusel on üks tähtsamaid rolle transkriptsiooni algussaidi positsioneerimisel. Siiski ei ole pea pooltel geenidel TATA-järjestusi või neil on sarnane järjestus võrrelduna TATA-ga. Teist konserveerunud järjestust nimetatakse CAAT-järjestuseks (ingl. CAAT box) ning see asub keskmise nukleotiidi suhtes tavaliselt positsioonis –80 ning tal on konsensusjärjestus GGCCAATCT. Kolmandaks konsensusjärjestuseks on GC-järjestus (ingl. GC box) konsensusjärjestusega GGGCGG ja neljandaks oktameerne järjestus (ingl. octamer box) konsensusjärjestusega AT TGCAT. Viimatinimetatud kaht konserveerunud järjestust ei ole kõigil RNA polümeraasi II poolt äratuntavatel promootoritel. Nende olemasolu tõstab aga promootorite transkriptsiooni initsiatsiooni efektiivsust. Nagu juba nimetasime, on RNA polümeraas II seondumiseks DNA-ga vajalik promootori eelnev seondumine rea põhiliste transkriptsioonifaktoritega. Lisaks seonduvad ja interakteeruvad promootoriga veel mitmed transkriptsioonifaktorid, mida nimetatakse tugevdajateks e. enhanseriteks (ingl. enhancers) ja nõrgestajateks e. vaigistajateks (ingl. silencers). Põhiliste transkriptsioonifaktorite seondumine peab toimuma kindlas järjekorras ja viisil. RNA polümeraas II puhul tähistatakse basaalseid transkriptsioonifaktoreid sümboliga TFIIX, kus X tähistab individuaalset transkriptsioonifaktorit. Promootori põhilise transkriptsiooni initsiatsioonikompleksi moodustumine algab interaktsioonil TFIID promootoriga (jn. 9.14). TFIID sisaldab TATA-seoselist valku, mis seondub TATA-järjestusega. Järgmisena ühineb TFIIA ja seejärel järjestatult teised transkriptsioonifaktorid. Transkriptsioonifaktor TFIIF seondub aga esmalt RNA polümeraasiga -140 -120 -100 -80 -60 -40 -20 0 +1 Transkriptsiooni alguspunkt ATTTGCAT konsensus GGCCAATCT konsensus TATAAAA konsensus GGGCGG konsensus GGGCGG konsensus Oktameerne järjestus GCjärjestus CAATjärjestus TATAjärjestus GCjärjestus Joonis. 9.13. RNA polümeraasi II äratundva promootori struktuur. TATA- ja CA AT-järjestused asuvad pea samades kohtades enamiku eukarüootide promootorites. GC- ja oktameersed järjestused võivad esineda või ka puududa: kui nad esinevad, asuvad nad väga erinevates kohtades ja neil on väga erinev koopiaarv. 278Transkriptsioon ja RNA protsessing 5´ 3´ 3´ 5´ -50 5´ 3´ 3´ 5´ ATATTTT TATAAAA 5´ 3´ 3´ 5´ 5´ 3´ 3´ 5´ A A ATATTTT TATAAAA B ATATTTT TATAAAA 5´ 3´ 3´ 5´ A B ATATTTT TATAAAA F 5´ 3´ 3´ 5´ A B ATATTTT TATAAAA F E -30 -10 +10 +30 +1 Transkriptsiooni alguspunkt +1 +1 +1 +1 +1 RNA polümeraas II Transkriptsioonifaktor TFIID seondub TATA-järjestusega 1 2 3 Transkriptsioonifaktor TFIIA seondub initsiatsioonikompleksiga Transkriptsioonifaktor TFIIB seondub initsiatsioonikompleksiga Transkriptsioonifaktor TFIIF (lahtikeerav aktiivsus) ja RNA polümeraas II seonduvad initsiatsioonikompleksiga Transkriptsioonifaktor TFIIE seondub initsiatsioonikompleksiga 4 5 D D Joonis 9.14. Eukarüootse transkriptsiooni initsiatsioon RNA polümeraas II-ga. Esmalt seondub DNA-ga transkriptsioonifaktor TFIID (1), seejärel järjestikuliselt TFIIA (2), TFIIB (3), TFIIF (millel DNA-d lahtikeerav aktiivsus) koos RNA polümeraas II-ga (4) ja initsiatsioonikompleksi moodustamise lõpetab TFIIE (5). Transkriptsioon ja RNA protsessing 279 II ning nende kompleks ühineb edaspidi juba transkriptsiooni initsiatsiooni kompleksiga. TFIIF koosneb kahest alaüksusest, millest ühel on DNA-d lokaalselt lahtikeerav aktiivsus. Lõpuks seondub initsiatsioonikompleksiga transkriptsioonifaktor TFIIE, mis seondub DNA-ga transkriptsiooni alguspunktist allavoolu (transkriptsioonikompleksi et e). Lisaks tuleb nimetada transkriptsioonifaktorit TFIIH, mis seondub pärast TFIIE-d. TFIIH-l on helikaalne aktiivsus ning ta liigub elongatsiooniprotsessis koos RNA polümeraas II-ga mööda DNA-d, keerates DNA-ahelaid transkriptsioonisilmas lahti. R NA polümeraaside I ja III promootorid on märgatavalt erineva nukleotiidse järjestusega, ehkki nad võivad sisaldada RNA polümeraas II promootoritega samu cis-toimelisi elemente (ingl. cis-acting elements). RNA polümeraas I promootorid on kahetised, kus põhijärjestused lokaliseeruvad piirkonnas –45 kuni +20 ning lisaks seonduvad kontrollelementidega ülesvoolu piirkonnas –180 kuni –105. Neil kahel piirkonnal on sarnased nukleotiidsed järjestused ning nad on GC-rikkad alad. Transkriptsiooni initsiatsiooniks piisab põhijärjestusest, kuid transkriptsiooni initsiatsiooni efektiivsust tõstab tugevalt ülesvoolu esinev kontrollelement (enhanser). Erinevalt RNA polümeraasidest I ja II asub enamus RNA polümeraas III promootorjärjestustest hoopis transkriptsiooni initsiatsioonisaidist allavoolu. 1.3.3. RNA-ahela elongatsioon ja 5´-metüülguanosiinmütsi lisamine Pärast seda kui RNA polümeraas vabaneb promootori initsiatsioonikompleksi põhilistest transkriptsioonifaktoritest, järgneb RNA-ahela pikenemine (elongatsioon) sama mehhanismi alusel, nagu seda teeb prokarüootide RNA polümeraas. Paralleelselt elongatsiooniga, kui kasvav RNA-ahel on vaid ca 30 nukleotiidi pikkune, toimub pre-mRNA 5´-otsa modifitseerimine (jn. 9.15). Pärast transkriptsiooni GTP 2´-O-metüültransferaas Transkriptsiooniüksus RNA polümeraas II Lühike DNA/RNA kaksikheeliks Lahtikeerdumissait Kinnikeerdumissait Ribonukleotiidide sisenemise sait Pre-mRNA DNA 5´ 7-MG 5´ 3´ CH3-GpppNpNp CH3 CH3-GpppNpNp GpppNpNp pppNpNp Guaniin-7-metüültransferaas Guanüültransferaas PPi + Pi 5´-müts Joonis 9.15. 7-metüülguanosiinmütsi lisamine biosünteesiahelale. 7-me t ü ü l g u a no s i i n - (7- MG -) müts lisatakse pre-mR M A 5´-otsa (5`-5`-trifosfaat: ebaharilik side) pea kohe pä ra st elongatsioon i algust. 280Transkriptsioon ja RNA protsessing lisatakse raku biosünteetilise ahela toimel 7-metüülguanosiin-(7-MG)-müts. 7-MG lisatakse 5`-otsa tagurpidi ebahariliku 5´- 5´-trifosfaatse sidemega ning ta sisaldab kaht või rohkemat metüülgruppi. 7-MG-mütsi tunnevad ära valgulised faktorid, mis toimivad translatsiooni initsiatsioonil. 7-MG-müts aitab ka oluliselt kaitsta kasvavat RNA-ahelat nukleaaside de gradatsiooni eest. Kuivõrd eukarüootne DNA on seotud nukleosoomsesse struktuuri, peavad transkriptsioonil nukleosoomid kas lagunema või võimaldama neis seotud DNA-ahela transkriptsiooni muul viisil. Selgus, et R NA polümeraas II on võimeline mööduma nukleosoomidest kromatiini transkriptsiooni soodustava valgulise FACT-kompleksi (ingl. facilitates chromatin transcription) olemasolul. FACT-kompleks kõrvaldab nukleosoomist histoonide H2A/H2B dimeerid, jät es sellega nukleosoomid heksameerseteks. Pärast polümeraas II möödumist nukleosoomikohast restaureeritakse algsed nukleosoomid (taaslülituvad H2A/H2B dimeerid) FACT-kompleksiga kaasnevate muude valkude koostoimel. Samas, sõltuvalt olukorrast, võivad nukleosoomid vabaneda ka täies ulatuses ja asendatakse uutega (s.t. et toimub de novo nukleosoomse struktuuri taastamine) juba pärast transkriptsiooni. 1.3.4. RNA-ahela terminatsioon ja 3´-polü(A)-saba lisamine RNA polümeraas II ei tunne ära spetsiifilisi terminatsioonisignaale. Seetõttu moodustuvad transkripti 3´-lõpud endonukleaasse lõikamise tulemusena. Tavaliselt termineerub transkriptsioon paljudes erinevates punktides ning piisava varuga, tüüpiliselt 1000–2000 nukleotiidi allavoolu hilisemast küpsenud (valminud) transkripti 3´-otsast. Transkripti 3´-ots täpsustatakse endonukleaasi toimel. Tavaliselt moodustub Transkriptsiooniüksus RNA polümeraas II AAUAAA GC-rikas järjestus Polü(A)-saba Lõikamine endonukleaasiga -müts 5´ 7-MG 5´ 3´ Endonukleaasne katke AAUAAA 5´ 3´ -müts AAUAAA 5´ AAAAA(A)195 3´ Polü(A)-saba lisamine polü(A)-polümeraasi abil Joonis 9.16. Polü(A)-saba lisamine eu ka r üood i tra nsk r ipt i 3´-otsa ensüümiga polü(A)-polümeraas. Polü(A)-polümeraasile vajalik vaba 3´-OH ots moodustub pre-mRNA transkriptil polüadenülatsioonisignaalist allavoolu ja enne GC-rikast järjestust endonukleaasse katkemisega. Polüadenülatsioonisaidis on konsensusjärjestus A AUA A A. Transkriptsioon ja RNA protsessing 281 lõikamisel 3´-ots 11–30 nukleotiidi kaugusel allavoolu RNA transkriptis olevast konsensusjärjestusest AAUAAA ning ülesvoolu DNA transkriptsiooniüksuse lõpu lähedal paiknevast GC-rikkast piirkonnast (jn. 9.16). Pärast endonukleaasset lõikamist lisab ensüüm polü(A)-polümeraas transkripti 3´-otsa polü(A)-saba, mis koosneb kuni 200 ühesugusest nukleotiidist – adenosiinmonofosfaadist. Seda protsessi nimetatakse polüadenülatsiooniks (ingl. polyadenylation). Järelikult on polü(A)-saba moodustamiseks vaja transkripti spetsiif list 3´-otsa, mis moodustub AAUAAA-järjestust äratundva komponendi, GC-rikka järjestust stimuleeriva faktori, endonukleaasi ja polü(A)-polümeraasi toimel. Eukarüootide mRNA polü(A)-saba suurendab oluliselt transkripti stabiilsust ja tal on tähtis rolll mRNA transportimisel tuumast tsütoplasmasse. RNA polümeraasid I ja III tunnevad aga ära kindlaid terminatsioonisignaale. RNA polümeraas I termineerib transkriptsiooni 18 nukleotiidi pikkusega järjestusel, kuhu on eelnevalt seondunud terminatsioonivalk. RNA polümeraas III reageerib terminatsioonisignaalile analoogselt E. coli´s toimuva Rho-sõltumatu terminatsiooniga. 1.3.5. RNA korrektuur Molekulaarbioloogia põhidogma kohaselt ei muutu geneetilise informatsiooni ülekande vaheetappidel (DNA-st mRNA-ks) geneetiline informatsioon. Erandjuhtudel võib see aga siiski toimuda. Üheks RNA muutumise mehhanismiks on RNA korrektuur e. RNA redigeerimine (ingl. RNA editing), kus mRNA-s olevat geneetilist informatsiooni muudetakse juba sünteesitud mRNA-molekulis. RNA editeerimisel muudetakse vastava geeni geneetilist informatsiooni kahel viisil: 1) üksikute N-aluste struktuuri muutmisega; 2) uridiinmonofosfaadi jääkide (U) lisamise või kõrvaldamisega. 1.3.5.1. Lämmastikaluste muutmine mRNA-s RNA editeerimisel muudetakse mRNA-molekulis lämmastikaluste struktuuri. Seda protsessi tuleb harva et e, vaid üksikutel spetsiif listel juhtudel. Näiteks toimub C → U konversioon, kus järjestikuspetsiifiline RNA-ga seonduv valk kõrvaldab tsütosiinist aminogrupi. Nimetatud protsess toimub näiteks CAA- (glutamiini-) koodonis, mis muudetakse tsütosiini desamiinimisel transkriptsiooni terminatsioonikoodoniks UAA. Järelikult kõrvaldatakse siin geeni avaldumine mRNA editeerimise tasemel, sest stoppkoodoni moodustumisel ei saa tekkida enam terviklikku polüpeptiidi – vastava geeni produkti. Järelikult on mRNA editeerimisel geeni avaldumisele regulatiivne toime. Käsitletavat tüüpi R NA editeerimine avastati roti ja inimese apolipoproteiin-B (apo-B) geenide mRNA-de puhul (jn. 9.17). Apolipoproteiinid on veres olevad valgud, mis transpordivad erinevat tüüpi rasvamolekule. Maksas kodeerib apolipoproteiini apo-B-mRNA terviklikku 4563-aminohappelist polüpeptiidi, seedetraktis aga lühikest 2153-aminohappelist polüpeptiidi, sest C → U konversiooniga moodustus siin transkriptsiooni terminaatorkoodon UA A. Sama tüüpi N-aluste konversiooni on näidatud ka rot ide ajurakkudes glutamaadi retseptorvalgu puhul. Taimede mõnedes mitokondriaalse DNA määratud transkriptides muudetakse aga lausa enamik C-sid U-deks. 282Transkriptsioon ja RNA protsessing 1.3.5.2. Uridiinmonofosfaatide lisamine ja kõrvaldamine mRNA-s U-nukleotiidide lisamine või kõrvaldamine mR NA-molekulidest on kompleksne protsess, mida teostavad teatud mitokondriaalsete geenide poolt moodustatavad madalmolekulaarsed giid-RNA-d (ingl. guide RNAs, gRNA). Giid-RNA-d sisaldavad järjestusi, mis on vaid osaliselt homoloogsed korrigeeritava pre-mRNA-järjestustega. Giid-RNA ja korrigeeritava pre-mRNA paardumine põhjustab mRNA-s tühikute ja giid-RNA-s mittepaardunud A-nukleotiidide moodustumist. R NA korrigeerimisel kasutatakse gRNA-d matriitsina A-aluste vastu U-lämmastikaluste lisamisel mRNA tühikutesse. Saame informatsiooniliselt muudetud e. editeeritud mRNA. Nimetatud protsessi on kirjeldatud näiteks alglooma Leishmania tarentolae mitokondrites (jn. 9.18). See viburloom põhjustab inimesel aafrika unitõbe. Ehkki seda tüüpi RNA korrigeerimise geneetiline tagapõhi on veel ebaselge, on selgunud, et nimetatud nähtusel on nii trüpanosoomide kui ka taimede mitokondriaalsete geenide avaldumisel põhiroll. 3´ 5´ C A A 3´ 5´ COOH CAA GTT CAA 5´ 3´ 5´ 3´ 5´ C A A U 3´ H2N COOH H2N DNA maksas seedetraktis Redigeerimata mRNA Redigeeritud mRNA Transkriptsioon ja intronite splaissing RNA-seoseline desaminaas RNA redigeerimine: tsütosiini oksüdatiivne desamiinimine Translatsioon Apolipoproteiin: 4563 aminohapet Apolipoproteiin: 2153 aminohapet Joonis 9.17. Apolipoproteiin A mRNA editeerimine loomade seedetraktis. CA A-koodonis tsütosiini oksüdatiivsel desamiinimisel moodustub tsütosiinist uratsiil ja koodon muutub stoppkoodoniks UA A. RNA redigeerimise tulemusel moodustub üle kahe korra lühem valguline produkt. Transkriptsioon ja RNA protsessing 283 Meeldejätmiseks • Eukarüootidel on kolm erinevat RNA polümeraasi, mis on spetsialiseerunud eri tüüpi geenide transkriptsiooniks. • Eukarüootsete geenide transkriptidel toimub valdavalt kolm erinevat tüüpi RNA protsessingut e. modif tseerimist: 1. 7-metüülguanosiinmütsi lisamine 5´-otsa; 2. polü(A)-saba lisamine 3´-otsa; 3. mittekodeerivate intronjärjestuste kõrvaldamine (geeni splaissing). • RNA redigeerimisega toimub eukarüootsete geenitranskriptide informatsiooni muutmine, sest enne translatsiooni leiavad aset muudatused nende geenide mRNA-de nukleotiidses koostises ja järjestuses. TTTCGCCTCTCTTTTCTTTTCCGAAATTGAAGTCCAACAAATAATGCTCATATACC Transkriptsioon 5´ 3´ 3´ 5´ 3´ 5´ DNA matriitsahel Pre-mRNA AAAGCGGAGAGAAAAGAAAAGGCUUUAACUUCAGGUUGUUUAUUACGAGUAUAUGG 5´ 3´ AAAGCGGAGAGAAAAGAAA A G G C UUUAACUUCAGGUUGUUUAUUACGAGUAUAUGG UUUAAAUAUAAUAGAAAAUUGAAGU AUAUUCAAUAAUAAAU UCAGUAUACACUAUAAUAAUAAU 3´ 5´ 5´ 3´ AAAGCGGAGAGAAAAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGUUUAUUACGAGUAUAUGG UUUAAAUAUAAUAGAAAAUUGAAGU AUAUUCAAUAAUAAAU UCAGUAUACACUAUAAUAAUAAU 5´ 3´ AAAGCGGAGAGAAAAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGUUUAUUACGAGUAUAUGG Paardumine osaliselt komplementaarse giid-RNA-ga Uridiinmonofosfaatide insertsioon Giid-RNA vabanemine mRNA-st Redigeeritud mRNA Giid-RNA Giid-RNA Pre-mRNA Pre-mRNA Joonis 9.18. Mitokondriaalse tsütokroom b pre-mRNA redigeerimine trüpanosoomil Leishmania tarentolae. Pre-mRNA paardub osalise komplementaarsusega giid-RNA-ga. Giid-RNA paardunud lõigus on kaheksa A-d, mis pre-mR NA-s puuduvad: paardumisel täidetakse need kaheksa tühikut uridiinmonofosfaatide lisamisega. RNA redigeerimisel muudetakse mRNA-s olevat geneetilist informatsiooni ning saadakse muutunud redigeeritud mRNA ja translatsioonil täiesti muutunud polüpeptiid. 284Transkriptsioon ja RNA protsessing 2. GEENIDE INFORMATSIOONILINE KATKENDLIKKUS Enamik prokarüootseid geene on pidevad, s.t. et nende nukleotiidid on järjestunud pidevalt määramaks aminohapete järjestust polüpeptiidides (geeni produktides). Seevastu eukarüootsetes geenides paiknevad enamasti geeni kodeerivate alade vahel mit ekodeerivad alad. Seega on need geenid katkendlikud, sisaldades vahejärjestusi (ingl. intervening sequences) e. introneid. Neid geenijärjestusi, mis jäävad mRNA koosseisu ka pärast intronite RNA-st kõrvaldamist e. geeni splaissingut (ingl. gene splicing), nimetatakse ekspresseeruvateks järjestusteks (ingl. expressed sequences) e. eksoniteks (ingl. exons). 2.1. Eukarüootsed katkelised geenid Ehkki intronid on enamikul loomade ja taimede geenidel, pole nad hädavajalikud, sest osas geenides pole introneid. Esmalt näidati introniteta geenide leidumist merisiiliku histoonigeenides ja Drosophila kuumašokigeenides. Praegu on teada aga juba väga palju selliseid geene. 2.1.1. Eksonid ja intronid Intronite olemasolu tõestati esmakordselt imetajate β-globiini geenil. Näidati, et hiire β-globiini geeni mRNA, mis oli tsütoplasmast eraldatud, hübriidus selle geeni DNA-ga vaid nendes piirkondades, kus moodustus RNA-DNA dupleks (kaksikahel). Mit ehübriidunud piirkondades oli aga DNA-ahel nähtav väljaulatuva linguna. RNA-DNA hübriidis mit epaardunud üksikahelalisi linge hakati nimetama R-lingudeks (ingl. R-loops). Seevastu tuumast eraldatud β-globiini geeni pre-mRNA hübriidus β-globiini geeni DNA-ga pea täies ulatuses, ilma R-linge moodustamata. Siit järeldus üheselt, et algsest mRNA-st lõigatakse kindlad segmendid välja ja protsessitud RNA transporditakse seejärel tsütoplasmasse. Intronitega geenid võivad olla väga komplekssed, sisaldades hulgaliselt introneid. Kui β-globiini geenis on vaid kaks intronit (ja kolm eksonit), siis näiteks kannuskonna (Xenopus laevis) vitelliini A2-geenis (määrab muna rebuvalgu) on 33 intronit ja tibude 1α2 kollageeni geenis 50 intronit. Kollageenigeen on 37 000 nukleotiidipaari pikkune, kuid valminud introniteta mRNA on vaid 4600-nukleotiidiline. Senikirjeldatutest on suurimaks geeniks inimese Duchenne’i lihasdüstroof a geen DMD, mille mutantne vorm põhjustab selle raske päriliku haiguse teket. Nimetatud geeni pikkuseks on 2,5 miljonit nukleotiidipaari ning ta sisaldab 78 intronit. Teisalt, osas geenides, mis sisaldavad suhteliselt vähe introneid, võib olla üksikuid väga pikki introneid. Näiteks Drosophila Ultrabithorax’i (Ubx) geen sisaldab intronit, mis on 70 000 nukleotiidipaari pikkune. Intronite bioloogilise tähtsuse kohta pole veel kõik teada. Osa introneid sisaldab regulatoorseid alasid, mis mõjutavad geenide avaldumist. Tähtsaim on aga alternatiivse splaissingu tagajärjel intronite ja eksonite väljalõikamisel saadav geenifragmentide kombinatoorika ja seetõt u erinevate geenivariantide poolt erinevate valkude moodustamine, näiteks immuunvastusena antikehade moodustamine B-lümfotsüütidest. Ilmselt puudub osal intronitel siiski bioloogiline funktsioon. Ka arvatakse, et intronid võivad olla nukleotiidseks varumaterjaliks uute geenide tekkel ja organismide evolutsiooniliseks geneetiliseks reserviks. Transkriptsioon ja RNA protsessing 285 2.1.2. RNA splaissing Valku kodeerivate geenide pre-mRNA splaissing peab toimuma väga täpselt, et mRNA saaks kodeerida funktsionaalset valku. Eksonite ühinemisel moodustub kahe eksoni vahele koodon, mis on vajalik funktsionaalse valgu moodustumiseks (jn. 9.19). Intronite täpne väljalõikamine peab toimuma nukleotiidi täpsusega. Rakutuumas asuvate valke moodustavate geenide intronite otstes asuvad 100%-liselt konserveerunult dinukleotiidid: nimelt GT-nukleotiidid intronist 5´-suunda jääva eksoni kõrval ja AG-nukleotiidid intronist 3´-suunda jääva eksoni kõrval. Introni otstest sissepoole jäävad vähemkonserveerunud alad. Eksoni-introni ühildumise alad on tRNA-geenide ja mitokondrite ning kloroplastide struktuurgeenide puhul siiski erinevad ning seal esinevad seepärast ka teistsugused splaissingumehhanismid. Lisaks esineb üks lühike konserveerunud järjestus, TACTA AC-järjestus, mille kuuendas positsioonis asuv A on 100%-liselt konserveerunud. Pärmseente geenides on kogu TACTAAC-järjestus konserveerunud. TACTAAC-järjestus asub tuumageenides introni 3´-splaissingusaidist 30 nukleotiidi ülesvoolu. Tänapäeval tuntakse RNA transkriptidest kolmesugust intronite väljalõikamise mehhanismi. 1. tRNA eellasmolekulides toimub intronite täpne endonukleaasidega väljalõikamine ning eksoneid sisaldavate RNA-segmentide ühendamiseks toimuvat ligeerimisreaktsiooni katalüüsib spetsiif line splaissingu endonukleaas, vajalik on ka splaissingu ligaasi aktiivsus. 2. Mõnede rRNA eellasmolekulide intronid kõrvaldatakse autokatalüütiliselt, unikaalse keemilise reaktsiooniga (splaissinguga), mida teostavad RNA-molekulid ise (RNA kui ensüüm). 5´ 3´ Ekson 1 DNA Intron A Intron B Ekson 2 Ekson 3 Geen Ekson 1 Ekson 2 Ekson 3 Intron A Intron B Koodon n Koodon n+1 Primaarne transkript RNA protsessing Transkriptsioon Translatsioon mRNA Polüpeptiid Koodon n n+1 Ekson 1 Ekson 2 Ekson 3 n n+1 Joonis 9.19. Intronite vä lja lõikamine primaarsetest transkriptidest RNAsplaissing ul. Splaissing u mehhanism garanteerib intronite nukleotiidilise täpsusega väljalõikamise. Ülesvoolu eksoni koodon ühineb järgneva allavoolu asuva eksoniga nii, et valgulises produktis saavutatakse õigete aminohapete lülitumine polüpeptiidahelasse. 286Transkriptsioon ja RNA protsessing 3. Tuuma pre-mRNA e. heterogeenne tuuma mR NA (hnR NA) (ingl. heterogenous nuclear mRNA, hnRNA) transkriptidest lõigatakse intronid välja kaheetapilise splaissingureaktsiooniga, mida teostab kompleksne riboproteiinne partikkel – splaissosoom. 2.1.2.1. tRNA eellaste splaissing tRNA eellaste splaissingul teeb katked RNA-ahelasse spetsiifiline splaissingu endonukleaas ja RNA segmentide eksonid ühendatakse splaissingu ligaasi abil. tR NA splaissingureaktsioone on põhjalikumalt uuritud pagaripärmil (Saccharomyces cerevisiae). Pärmseente tRNA eellasmolekulidest kõrvaldatakse intronid kaheetapiliselt (jn. 9.20). 1. Etapis I põhjustab tuumamembraaniga seondunud splaissingu endonukleaas (ingl. splicing endonuclease) intronite otstesse kahe katke tekke. 2. Etapis II ühendab splaissingu ligaas (ingl. splicing ligase) tRNA kaks poolt, moodustades valmis tRNA. 3´ 5´ P 3´ OH 3´ OH 5´ P 3´ OH HO 3´ OH 5´ P 5´ P 5´ P P OH OH P Intron tRNA eellane Splaissingu endonukleaas Splaissingu ligaas Introni järjestus Küps tRNA I etapp II etapp Joonis 9.20. tRNA eellasmolekulist introni väljalõikamise kaheastmeline protsess. I etapp. Introni mõlemas lõpus teostatakse splaissingu endonukleaasi toimel katkemised. II etapp. Uuesti moodustunud eksonite lõpud ühendatakse splaissingu ligaasiga. Ligeerimisel toimub splaissingu ligaasi toimel kolm protsessi: splaissingu ligaasil on fosfodiesteraasi, kinaasi ja ligaasi aktiivsus. Need ensüümid tunnevad ära eelkõige tRNA prekursorjärjestuse kõrgema järgu struktuure, mit e aga kindlaid nukleotiidijärjestusi per se. 2.1.2.2. Autokatalüütiline splaissing Osade rRNA prekursorite puhul, eriti alamatel eukarüootidel (nt. Tetrahymena thermophila) ning mitokondrite ja kloroplastide rRNA-s, tRNA-s ja mRNA-s kõrvaldatakse intronid autokatalüütiliselt RNA-molekuli enda poolt. Seda nimetatakse RNA iseeneslikuks splaissinguks e. autokatalüütiliseks aktiivsuseks (ingl. RNA self-splicing or autocatalytic activity). RNA ensümaatilise aktiivsuse avastasid 1982. a. T omas R. Cech Transkriptsioon ja RNA protsessing 287 (snd. 1947) ja kaastöötajad. 1989. a. said T. R. Cech ja Sidney Altman (snd. 1939) nimetatud avastuse eest Nobeli preemia. Autokatalüütilise splaissingu mehhanism on sarnane sellega, mis toimub pre-mRNA puhul splaissosoomide abil, kuid siin pole vaja ei välist energiaallikat ega spetsiif liste valkude aktiivsust. Selle asemel toimub rida fosfodiestersidemete ülekandeid, ilma et neid sidemeid kaotataks või uusi loodaks. Reaktsioonil on kofaktorina vajalikud vaba 3´-OH-ga guanosiinnukleosiidid või -nukleotiidid (GTP, GDP, GMP) ning monovalentne ja divalentne katioon. Absoluutselt vajalik on G(guanosiin)-3´-OH olemasolu. Splaissing on etapiviisiline (jn. 9.21). Kõigepealt toimub fosfodiestersideme ülekanne eksoni-introni ühendusalalt G(guanosiin)-3´-OH-le, mille tõttu selles punktis RNA-ahel ka katkeb. Seejärel katkeb fosfodiesterside järgmise eksoni ja introni 3´-otsa vahel ning vastavate eksonite vahel moodustub fosfodiesterside. Väljalõigatud intron muutub ringjaks molekuliks veel ühe fosfodiestersideme ülekandega. Järelikult ei esine siin mitte mingit trans-katalüütilist aktiivsust (ensüümide toimel), vaid cis-katalüütiline aktiivsus, mis on määratud RNA-molekuli struktuuri endaga. -OH 3´ 5´P5´P5´P- -OH 3´ -OH 3´ OH U-O-P G-OH U-O-P O-PUpA UpA U-O G-PEkson 1 Ekson 1 Ekson 1 Ekson 2 Ekson 2 Ekson 2 Väljalõigatud intron Splaissitud rRNA Intron Intron Introni fragment Rõngasjas intron rRNA eellane Ribosüümne aktiivsus Eksoni splaissing + Joonis 9.21. Autokatalüütilise splaissingu mehhanism Tetrahymena thermophila rR NA eellasmolekulis. Autokatalüütiliseks splaissinguks on vaja vaba guaniinnukleosiidi või -nukleotiidi 3´-OH otsa. Fosfodiestersidemete ülekandega lõigatakse intron välja ja vabanenud intron võib tsirkulariseeruda. 
2 Transkriptsioon ja RNA protsessing 289 fosfodiesterside (jn. 9.22). Protsessis osaleb kogu splaissosoom, kuid enne katke teket on vajalik, et splaissingusaidiga seostuks esmalt U1 snRNP. Introni 5´-katkesaidi äratundmiseks on vajalik aluspaaride paardumine konsensusjärjestuse ja snRNA 5´-terminuse lähedal oleva komplementaarse järjestusega. Teiseks snRNP-ks, mis ühineb splaissingukompleksiga, on U2 snRNP, seostudes A-jääki sisaldava konsensusjärjestusega, nn. harusaidiga. Edasises protsessis osaleb juba kogu splaissosoom. Järgnevalt ühinebki introni 5´-ots harusaidi A-ga, moodustades nn. lariantstruktuuri ning U1 ja U4 vabanevad. Edasi tekib katke introni 3´-splaissingusaidis, millega vabaneb eksoni 2 5´-ots. Protsessi lõpetamisel ühineb 3´-otsa ekson 2 eksoniga 1 (fosfodiestersideme moodustumine). Vabaneb lariantstruktuur koos snRNP-dega U2, U5 ja U6. Süsteemse erütomatoosluupuse (ingl. systemic lupus erythematosus, SLE) patsientidel on autoantikehad, millega saab snRNP-sid hõlpsasti välja sadestada. Nimetatud autoimmuunhaiguse puhul moodustuvad organismis antikehad, mis reageerivad organismis paljudele rakulistele komponentidele, k.a. snRNP valkudele. Neid antikehasid nimetatakse autoantikehadeks (ingl. autoantibodies). Autoantikehad põhjustavad patsientidel pikaajalist kudede närbumist ja organite kärbumist, millega võib kaasneda ka organismi hukkumine südame-, maksa- ja neerufunktsiooni häirete tõttu.